Monday, September 30, 2019
Cyber Crimes
Businesses are becoming more and more reliant on the Internet in modern society and it is important to study the crimes that are committed electronically. There are criminals on the Internet just as there are criminals on the street, the Internet has several common crimes that businesses need to understand. Users on the Internet have rights and violating these rights are the same as violating rights in person. The Internet has laws. That means that people need to be aware of cyber laws and illegal cyber activity. Torts made on the Internet are referred to as cyber torts. Torts are simply violated someone.To start, there are several instances where a person is violated on the Internet. The primary example of being violated in cyber space is defamation. Defamation is essentially any type of slander against someone on the Internet. Whether it is through a blog post, video post, chat room, or message board, attempting to harm someoneââ¬â¢s reputation is against the law. The person com mitting the crime of defamation can be sued for libel. It is wrong to try and ruin someoneââ¬â¢s reputation and businesses need to realize that even if they are just joking around, saying derogatory things about someone is against the law.However, the Internet Service Provider cannot be held accountable for someone committing defamation. The Internet is a place of freedom but abusing that freedom cannot be the fault of the service provider. The Federal Communications Decency Act was created to protect these ISPââ¬â¢s and remind users to be decent on the Internet. Several laws have been created due to people abusing the Internet and the service providers are not to be blamed. To continue on the topic of cyber crimes, spam e-mails are constantly being thrown around but only some are actually legal.If a user is sending so much spam e-mail that it slows down the use of the computer or disrupts the Internet Service Provider, then it is a crime. The trespass of chattels is interferi ng with a personââ¬â¢s use of the Internet. All the junk e-mails and pop-ups are annoying for userââ¬â¢s and is considered a violation. However, the use of these spam type e-mails for commercial use is allowed. The Internet is a great way to advertise so companies are allowed to send bulk e-mail all around the Internet to hope generate some business. It is definitely important for businesses to understand how to properly use spam e-mails.Also, financial crimes are beginning to become more common on the Internet. So much banking and paying bills is done electronically now and it has is pros and cons. Being able to use the Internet for tedious activities like banking is great. However, all of a personââ¬â¢s information is now on the Internet, a very public place. Identity theft is a serious offense committed in cyber space. A person can find all of the information needed such as social security numbers, date of birth, motherââ¬â¢s maiden name, and all kinds of information about a person that would lead to identity theft.Users need to be extremely careful when entering any financial information on the Internet because it can lead to crimes like identity theft. Businesses need to be extremely careful when putting anything on the Internet. It can destroy a business if someone can access all of the companyââ¬â¢s records and private information. These crimes are very serious and the culprits face serious consequences. Overall, all of these types of cyber crimes are important for businesses to understand because so much business is done on the Internet nowadays.Companies are taking more and more precautions to avoid all kinds of cyber crimes. Violating someone on the Internet is the same as violating someone in person. There are now cyber laws and breaking these laws has real consequences. From spam e-mails to defamation to identity theft, businesses need to understand all of the dangers that exist out there in cyber space. Knowing the laws will protect businesses and guide employees to stay within the boundaries of the law and keep the company strong. Cyber Crimes Businesses are becoming more and more reliant on the Internet in modern society and it is important to study the crimes that are committed electronically. There are criminals on the Internet just as there are criminals on the street, the Internet has several common crimes that businesses need to understand. Users on the Internet have rights and violating these rights are the same as violating rights in person. The Internet has laws. That means that people need to be aware of cyber laws and illegal cyber activity. Torts made on the Internet are referred to as cyber torts. Torts are simply violated someone.To start, there are several instances where a person is violated on the Internet. The primary example of being violated in cyber space is defamation. Defamation is essentially any type of slander against someone on the Internet. Whether it is through a blog post, video post, chat room, or message board, attempting to harm someoneââ¬â¢s reputation is against the law. The person com mitting the crime of defamation can be sued for libel. It is wrong to try and ruin someoneââ¬â¢s reputation and businesses need to realize that even if they are just joking around, saying derogatory things about someone is against the law.However, the Internet Service Provider cannot be held accountable for someone committing defamation. The Internet is a place of freedom but abusing that freedom cannot be the fault of the service provider. The Federal Communications Decency Act was created to protect these ISPââ¬â¢s and remind users to be decent on the Internet. Several laws have been created due to people abusing the Internet and the service providers are not to be blamed. To continue on the topic of cyber crimes, spam e-mails are constantly being thrown around but only some are actually legal.If a user is sending so much spam e-mail that it slows down the use of the computer or disrupts the Internet Service Provider, then it is a crime. The trespass of chattels is interferi ng with a personââ¬â¢s use of the Internet. All the junk e-mails and pop-ups are annoying for userââ¬â¢s and is considered a violation. However, the use of these spam type e-mails for commercial use is allowed. The Internet is a great way to advertise so companies are allowed to send bulk e-mail all around the Internet to hope generate some business. It is definitely important for businesses to understand how to properly use spam e-mails.Also, financial crimes are beginning to become more common on the Internet. So much banking and paying bills is done electronically now and it has is pros and cons. Being able to use the Internet for tedious activities like banking is great. However, all of a personââ¬â¢s information is now on the Internet, a very public place. Identity theft is a serious offense committed in cyber space. A person can find all of the information needed such as social security numbers, date of birth, motherââ¬â¢s maiden name, and all kinds of information about a person that would lead to identity theft.Users need to be extremely careful when entering any financial information on the Internet because it can lead to crimes like identity theft. Businesses need to be extremely careful when putting anything on the Internet. It can destroy a business if someone can access all of the companyââ¬â¢s records and private information. These crimes are very serious and the culprits face serious consequences. Overall, all of these types of cyber crimes are important for businesses to understand because so much business is done on the Internet nowadays.Companies are taking more and more precautions to avoid all kinds of cyber crimes. Violating someone on the Internet is the same as violating someone in person. There are now cyber laws and breaking these laws has real consequences. From spam e-mails to defamation to identity theft, businesses need to understand all of the dangers that exist out there in cyber space. Knowing the laws will protect businesses and guide employees to stay within the boundaries of the law and keep the company strong.
Sunday, September 29, 2019
One of the Main Messages in ââ¬Åa Christmas Carolââ¬Â Is That Love Elevates and Money Corrupts. Discuss. Essay
ONE OF THE MAIN MESSAGES IN ââ¬Å"A CHRISTMAS CAROLâ⬠IS THAT LOVE ELEVATES AND MONEY CORRUPTS. DISCUSS. The allegory of Charles Dickensââ¬â¢ ââ¬Å"A Christmas Carolâ⬠can be shaped by a variety of different outlooks. Dickens incites the reader by including a riddle of messages, some messages may be more imperative than others. One of the most outstanding messages within the novella is centred on money and love. The crux of Scroogeââ¬â¢s life is based on money, greed and gain twisted his ideals so to make him a wicked and corrupt man. Alternatively, love was also heavily included within the novella. Dickens illustrated how the love of a family and one another elevated all, and ultimately elevated Scrooge. Scrooge was a depraved man ââ¬Å"squeezing, wrenching, grasping, scraping, clutching, covetous old sinner!â⬠majority of the townsfolk would cower at this presence. He based his morality and life purely on money; greed and gain were his most prominent qualities. Love was a mere inkling of what was in Scrooge. His nephew Fred can be described as an outstanding foil to Scrooge, Fred was poor but lived a comfortable life; whereas Scrooge was rich and corrupt. ââ¬Å"Though it has never put a scrap of gold or silver in my pocket, I believe it has done me goodâ⬠, Fred commended Christmas even if there was no profit in it, whilst Scrooge condemned its every quality ââ¬Å"bah humbugâ⬠, alongside the fact that it made people happy. In Stave 1 when Scrooge is approached by Marleyââ¬â¢s ghost he was exposed to his former business partnerââ¬â¢s consequence. His spirit wore the ââ¬Å"chain (he) forged in lifeâ⬠, a chain linked by the ââ¬Å"dealings of (his) tradeâ⬠¦ a drop of water in the comprehensive ocean of (his) businessâ⬠. Marley and Scroogeââ¬â¢s ideals were parallel; they were hand in hand business partners.
Saturday, September 28, 2019
Khe Sahn, Leaving Home, Geography Lesson; Journey Theme Essay
Each personââ¬â¢s life undertakes a journey, whether it is physically or mentally. We all undergo our own adversities, tears, pains, and obstacles which can change yours and the societyââ¬â¢s perspectives of life. Journeyââ¬â¢s can be classified as a distance, course, travelled or appropriate for travelling. The poems ââ¬Å"Leaving Homeâ⬠by Peter Skrzynecki and ââ¬Å"Geography Lessonâ⬠by Brian Patten both include different techniques such as metaphors and imagery to emphasise the different processes, changes, choices and conflict that each person or character may face throughout a journey. Techniques are also used in the song ââ¬Å"Khe Sahnâ⬠composed by Donald Walker, providing a glance of how soldiers were treated in the war and the challenges they had to overcome, which all relate back to journeys. ââ¬ËLeaving homeââ¬â¢ is not just about the destination, but the process in which he goes through to get there, and what he learns along the way is what truly counts. The characterââ¬â¢s interview with head office caught him by surprise when the ââ¬Å"first country appointmentâ⬠left him and his family with a ââ¬Å"dull-witted, frog-mouthed obedienceâ⬠. This metaphor shows how unaware the family was about what could happen and that this was the beginning of his process through a journey. He learns along the way that he holds an unknown future and emotionally, this journey is taking its toll on him. The process within the journey helps determine the up-coming events, whether it is broken into steps or left in somebody elseââ¬â¢s hand to determine through the ride. In comparison to ââ¬ËLeaving Homeââ¬â¢, ââ¬ËKhe Sahnââ¬â¢ explores the quick change, that the main character experiences in the context, leaving the process to change his life rapidly. The hostile reception took a toll on the character and when returning from war it was extremely overwhelming. ââ¬Å"Iââ¬â¢ve had the Vietnam cold turkeyâ⬠is Walker showing the process that the character or inspiration of the text has experienced and that he had to abruptly withdraw from the war he witnessed and fought in. The context is providing an internal look on the character and the issues and conflicts he came across after the war. Earlier in the text we find that the character ââ¬Ëleft his heart to the sappers roundââ¬â¢ which means, this is him planting his heart to the Khe Sahn battle. Returning from the battle leaves him struggling to find himself mentally, indicating the process he experiences throughout his journey, and to find himself and whom he used to be so quickly. ââ¬ËGeography Lessonââ¬â¢ is the internal thoughts of a young student who shares his personal memories of his Geography teacher. Change is a major theme used throughout this poem. It overlooks his teacherââ¬â¢s life and the change he progresses. His belief that his Geography teacher should ââ¬Ësail across a warm blue seaââ¬â¢ to a place that he had ââ¬Ëonly known from mapsââ¬â¢ glimpses into the thought of the student and the goal in which he believes his teacher should achieve. ââ¬Å"He spoke of the lands he longed to visitâ⬠uses personal pronouns to illustrate that the journey is about his teacher and not the young student. ââ¬Å"And I couldnââ¬â¢t understand why he never leftâ⬠. The contrast between the two quotes emphasise the change and that he never got to the places he longed to visit, which makes the audience wonder ââ¬ËWhy didnââ¬â¢t he go to the lands?ââ¬â¢ ââ¬ËWhat happened to him?ââ¬â¢ directing the audienceââ¬â¢s attention to the obstacles involved in the journey, making us wonder how his journey ended. ââ¬ËLeaving homeââ¬â¢ establishes the conflict, change and hatred the character has towards head office, by using disjointed images to describe the office boys. With his family, the main appeal is set towards the ââ¬Ëunknownâ⬠where his distant future is set to thrive. Here we see the change in his attitude towards head office. It now presents his actual revulsion in them because of being sent somewhere that, to him, is unsatisfactory. Comparing the interview as trial and verdict makes the journey seem more daunting than it really is, with his disgust towards head office it is emphasised by using imagery, which highlights his loathing towards the office boys. ââ¬Å"Stood at a window, laughing in the rain, Clapping to a fiddlerââ¬â¢s music ââ¬â Their naked hairless bodies, The colour of sour milkâ⬠. The sickening imagery used ends the poem by making it appear that head office, leaves a bad taste in his mouth. The imagery reflects on the journey by showing the change from confusion to rapid repulsion that he has towards the office people. ââ¬ËKhe Sanhââ¬â¢ in itself, is very much like a poem. The lyrics explore the lack of support that we, as a society, put towards a particular issue. The lyrics demonstrates that by protesting through a song, it can help influence Australianââ¬â¢s thoughts to sympathise with the veteran soldiers that have undertaken the hardships throughout the battle. Along the way, the societyââ¬â¢s perspectives on the veterans changed. ââ¬Å"Well the last plane out of Sydneyââ¬â¢s almost goneâ⬠is a constant repetition throughout the composition, which helps get the message across that he is holding all this excess baggage from the war and all veterans hold onto that. Whilst the rest of society have moved on, forgotten about it, and donââ¬â¢t understand the adversity the ââ¬Ëvetsââ¬â¢ have gone through. The change from life after war takes a massive toll on the character, and the emotional journey from life after war is tough to break. But the choice for Walker to compose lyrics using the ââ¬ËKhe Sahnââ¬â¢ battle was to indicate the journey all veterans undertook and attempted to overcome. Whilst, ââ¬ËGeography Lessonââ¬â¢ uses symbolism to identify the place he had only known from maps. Pattenââ¬â¢s devotion towards the poem indicates a life full of experience and imagination, leaving you with an urge to ââ¬Ësail across a warm blue seaââ¬â¢ and get to the place the teacher ââ¬Ëlonged to visit.ââ¬â¢ Symbolism is used to create an effect on the audience by using repetition, (like in ââ¬ËKhe Sahnââ¬â¢), to describe the geography teachers ââ¬Ëheavenââ¬â¢. ââ¬Å"The green leaves of the orange trees burnedâ⬠is a constant line in the stanzaââ¬â¢s, used to help indicate his teacherââ¬â¢s dream. The imagery in this quote builds your imagination on what the place on the map is really like; seeming like it is a bright and positive place to be. The young student uses his teacher as his role model, reflecting on his own decisions in life. This emotional journey brings a sense of hope, desire, and dreams, to not waste your life, but to live it to the fullest. In conclusion, we all embark on a passage through life. Whether it be physically, mentally or emotionally. To get through a journey you only need to take one step at a time, but you must keep on stepping in order to complete your journey. This is found in ââ¬ËLeaving Homeââ¬â¢, ââ¬ËKhe Sahnââ¬â¢ and ââ¬ËGeography Lessonââ¬â¢, by overcoming their own pathways through life. Through these texts it is found that Journeys are full of ups and downs, twists and turns, and obstacles that all lead us to our final destination. It really does change our perspective of life itself.
Friday, September 27, 2019
Explain the Benefits of Gaining International Business Experience and Essay
Explain the Benefits of Gaining International Business Experience and Working as an Expat - Essay Example It will help in understanding cross cultural situations and will eventually contribute to the native countryââ¬â¢s cultural competence by making it more competitive and booming in the global marketplace. Benefits are offered to a worker depending upon the region in which a person is operating. A person working in some parts of Europe might not get the same benefits which would be offered in Middle East. Some of the most common benefits which are offered in most of the countries include the following. Many employers offer their employees a 30 day paid vacation. Individuals working at some senior status positions often get 40 days paid vacation. The benefits of vacation vary depending upon the size and status of family i.e., married, single or family. Most positions outside the native country offer a ââ¬Å"Yearly Contract Completion Bonusâ⬠. Employers held this type of bonus in escrow and paid to their employee when they re-patriate to their home country. Most of the positions offer transportation allowance to facilitate their employees. Others also furnish the automobiles. Generally, furnishing a car is primarily for those employees who are at sales positions or senior level. While working as an expatriate, some companies offer other benefits which include incentive bonuses, child education, perks, performance increases etc. All benefits are explicated by the recruiting staff of the relevant company. Richard Fearon. "Financial director."à Why getting international experience mattersà . 28th November 2010. Web. 10th September 2012.
Thursday, September 26, 2019
Film Review Essay Example | Topics and Well Written Essays - 750 words - 1
Film Review - Essay Example Plot The film ultimately narrates the production of Meet Pamela, a passe melodrama that stars Jean-Piere Aumon who is the aging movie icon, Valentina Cortese, Jean-Pierre Leaud and Jacqueline Bisset who is a British actor. It is evident from the film that Jacqueline Bisset who plays as Julie Baker in film, is recovering a nervous collapse as well as the controversy that leads her to marry the doctor who is much older. In between the film, there are various small vignettes. They include chronicle of the crewmembers stories and Truffaut who is the director of the film, faces with the numerous practical problems that a person faces when making a film. The film portrays that behind the cameras, the crew and actors go through many sorrows, break-ups, affairs and romances. The event that particularly shakes up the production is when the fiancee to Alphonse abandons him for the stuntman in the film and this leads him and Julie to have a one-night fling. The production is also shaken up when a car suddenly kills Alexandre and one of the supporting actors is discovered to be pregnant (Truffaut, 1986). The cast consists of Jacqueline Bisset who plays as Julie, Jean-Pierre Aumont plays Dani as Liliane, Valentina Cortese who plays as Severine, Alexandra Stewart who plays as Stacey, Alexandre, and Jean Champion plays as Bertrand. Nathalie Baye plays as Joelle, Jean-Pierre Leaud plays as Alphonse, Francois Truffaut is the Director of the film and he plays as Ferrand, David Markham plays Doctor Nelson whereas Zenaide Rossi plays Gastonââ¬â¢s wife as Madame Lajoie. Christian is Alexandreââ¬â¢s lover and it played by Xavier Saint-Macay, Bernard Menez plays the Property man, Nike Arrighi plays as Odile, Gaston Jolly plays Gaston whereas Jean Panisse plays as Arthur in the film. The rest of the cast includes the TV reporter, which is played by Maurice Seveno, Christophe Veasque plays as the dream boy in the Directorââ¬â¢s dream, and both Marcel Berbert and Henry Graham p lay the roles of the insurers (Truffaut, 1986). Theme One of the fundamental themes in the film is whether or not movies are more paramount than life in regard to those who are concerned in there making and production. The other theme is about the many illusions that are involved in both the actual movies as well as in filmmaking. It is also shocking to learn that Truffaut who is the director of the film started his noble career as a champion of cinema being an art form and as a film critic. Ferrand is shown in a scene where he opens a book package, which he had ordered. The books were on various directors that he admires who include Robert Bresson, Roberto Rossellini, Ernst Lubitsch, Jean-Luc Godard, Alfred Hitchcock, Ingmar Bergman, Carl Theodor Dreyer and Luis Bunuel (Truffaut, 1986). Graham Greene who is a film writer plays the role of an insurance company representative who is known as Henry Graham in the film. It has been reported on the movieââ¬â¢s DVD cover that Greene gr eatly admired Truffautââ¬â¢s work and he was looking for an opportunity to meet him
Extended Essay in Business and Management for the IB diploma
Extended in Business and Management for the IB diploma - Essay Example . The moÃ'â¢t critical iÃ'â¢Ã'â¢ue facing adidaÃ'⢠iÃ'⢠itÃ'⢠effort to turn around Reebok. The company bought Reebok for $3.8 billion 2006, a move criticized by many analyÃ'â¢tÃ'⢠aÃ'⢠being too expenÃ'â¢ive. The company iÃ'⢠working to change cuÃ'â¢tomerÃ'⢠perception Reebok from that of a diÃ'â¢count Ã'â¢hoe brand to a premium brand. AÃ'⢠part of theÃ'â¢e effortÃ'â¢, the company haÃ'⢠Ã'â¢witched the Reebok wholeÃ'â¢ale model from bulk pre-order to pay aÃ'⢠you go. WholeÃ'â¢ale cuÃ'â¢tomerÃ'⢠like Footlocker now order Reebok Ã'â¢hoeÃ'⢠aÃ'⢠they need them rather than ordering them in bulk. ThiÃ'⢠makeÃ'⢠it leÃ'â¢Ã'⢠likely that larger retailerÃ'⢠will diÃ'â¢count Reebok Ã'â¢hoeÃ'⢠in order to clear their inventorieÃ'â¢. AdidaÃ'⢠iÃ'â¢, at itÃ'⢠core, an international company with only 30% of itÃ'⢠2007 Ã'â¢aleÃ'⢠coming from North America. Moreover, it iÃ'⢠rapidly expanding itÃ'⢠preÃ'â¢ence in emerging marketÃ'⢠like AÃ'â¢ia and Latin America. BecauÃ'â¢e it targetÃ'⢠the wealthieÃ'â¢t Ã'â¢egmentÃ'⢠of the market the company leadÃ'⢠itÃ'⢠competitorÃ'⢠in Ã'â¢aleÃ'⢠in Japan, Korea, India, Thailand, IndoneÃ'â¢ia, and New Zealand; Ã'â¢aleÃ'⢠growth in itÃ'⢠core emerging marketÃ'⢠in Latin America and AÃ'â¢ia have haÃ'⢠topped 24% in the laÃ'â¢t Ã'â¢everal yearÃ'â¢. By 2010, management expectÃ'⢠China to be itÃ'⢠Ã'â¢econd biggeÃ'â¢t market. (CooperÃ'⢠and Lybrand, 2004, 77-84) AdidaÃ'⢠Group generateÃ'⢠revenue by Ã'â¢elling itÃ'⢠productÃ'⢠to retail Ã'â¢toreÃ'⢠or directly to the cuÃ'â¢tomer via one of the brandÃ'⢠concept Ã'â¢toreÃ'â¢, factory outletÃ'â¢, conceÃ'â¢Ã'â¢ion cornerÃ'â¢, or online Ã'â¢toreÃ'â¢. Of thiÃ'⢠revenue, 46% iÃ'⢠from footwear, 42% from apparel, and 12% from hardware. In 2007 the company had â⠬10.3 billion in revenue ($13.7 billion baÃ'â¢ed on the average 2007 exchange rate), which waÃ'⢠a 7% currency-neutral increaÃ'â¢e over 2006Ã'⢠revenueÃ'⢠of â⠬10.084 billion ($12.557 billion). While operating margin haÃ'⢠dropped overall Ã'â¢ince 2005, thiÃ'⢠can be attributed to the coÃ'â¢tÃ'⢠aÃ'â¢Ã'â¢ociated with integrating Reebok, which haÃ'â¢
Wednesday, September 25, 2019
A Church as One of the Important Foundations of Community Literature review - 2
A Church as One of the Important Foundations of Community - Literature review Example The culture of consumerism, according to Brooks (2), is the main problem that has undermined the biblical model. Communities frequently view the classical church as archaic or oppressive. As a result, the church is viewed by the public as a provider of religious services only. Furthermore, churches of different congregations have come to inventing multiple creative ways of attracting people to them ââ¬â attracting new ââ¬Ëclientsââ¬â¢, just like it happens in the corporate world. Churches compete among themselves to offer the most attractive array of programs to potential ââ¬Ëclientsââ¬â¢. People, in their turn, are free to move from one church to another depending on their individual needs or preferences. As a result, they do not form a single community of believers, because their interests and activities may be scattered across a wide array of different programs offered by different churches. So, the biblical discipline should be enforced in order for the communitie s to become more united. First of all, and it should be among the tasks of the church, it is necessary to deliver to the people the need for unity. Knowledge, intelligence and virtues are the foundation for making the church a community consolidation institute, instead of just a temporary community of parishioners (Hauerwas). Public and private moralities, as Stanley Hauerwas suggests, should be united in order for people to change their perception of churches. The society has to realize the very nature of the church as an institution.
Tuesday, September 24, 2019
Families Essay Example | Topics and Well Written Essays - 500 words - 1
Families - Essay Example Therefore, while defining the term ââ¬Å"familyâ⬠, it is important to mention that a group of individuals make a family irrespective of whether they love one another or not since they are blood-related to one another and are biologically family members. Often, family members assume financial obligations towards one another religiously if not legally. On the other hand, new concepts of family are emerging with the changing moods of the dynamic modern world, where homosexuality has been legally accepted in certain countries. But such concepts are man-made. It is highly unethical to consider such union of people as a family. In todayââ¬â¢s society, the definition of ââ¬Å"familyâ⬠I gave might not be quite welcomed and many people might find it offensive. Typically, the gays and lesbians would find it an offense of their fundamental beliefs. Todayââ¬â¢s modern society has given equal rights to homosexuals and straight people. This gives the homosexuals leverage to choose to live with the person they like irrespective of his/her gender. Homosexuals tend to make a family. But they certainly can not make babies in the natural biological way. This speaks of the natureââ¬â¢s definition of a family. Nature certainly does not consider them a family and accordingly does not bless them with children. That is why, homosexuals living together tend to develop themselves as a family by adopting children. This is highly unethical because it does not only ruin the fundamental structure of a family, but also inculcates many negative aspects in the personality of the adopted children. On the other hand, m any thoughtful people will consider this definition of family quite rational since it covers all major aspects of relationship between individuals forming a family. According to my definition of a family, individuals caught in a legal case should find help from their family members. Help comes in the form of financial support and psychological
Monday, September 23, 2019
Marketing Plan Essay Example | Topics and Well Written Essays - 250 words - 3
Marketing Plan - Essay Example First and foremost, marketing research should be carried out in order to establish the targeted customers. In this case, the target market includes the young and old people who are conscious about their health care issues. This will help us to establish the major threats and opportunities that might be faced by the product. This is followed by setting the marketing objective of this new product. In this case, the main objective is to achieve 10 % of the market share in the beverages industry during the first year of the product launch. The marketing strategy will involve the careful use of a marketing mix of price, product, place and promotion. When the marketing strategy has been outlined, then it is turned into specific action programs. This includes outlining the tasks and the people who will perform them in order to achieve the stated objectives. After implementation of this particular marketing plan, the company formulates control measures with the aim to monitor progress and to allow management to review implementation results and identify the areas that would be performing poorly. This ought to be an ongoing process. The first goal is customer satisfaction. The company targets to achieve a high level of customer satisfaction and improving on it every year. In so doing, the company aims at maximizing on opportunities for repeat business. In all cases, if a customer is satisfied by the goods offered in a company, they will be the biggest marketing tool since they will spread the word about goods and services. The second goal is to achieve good planning and reporting systems. This will help the company attract more investors and lenders hence, will serve top guide as a building pillar for the company. The third goal is employee training and development. This will help the company achieve maximum input and output from its employees. It facilitates efficiency such that things are done according
Sunday, September 22, 2019
Identifying Quantifiable goals for the monitor, control and effectiveness of the marketing plan Essay Example for Free
Identifying Quantifiable goals for the monitor, control and effectiveness of the marketing plan Essay In order to evaluate, monitor, and control the effectiveness of the marketing plan, identifying quantifiable elements are detrimental to V-Techs financial gains and holdings. Marketing campaigns are the most costly measurement to the company and the launch of V-Techs Virta Window new product line in its marketing practices needs to show financial accountability. The focus of controlling and effectiveness to quantifiable elements reside in the metrics analysis of: 1. Revenue 2. Sales 3. Lead generation 4. Sales feed back 5. Return on investment 6. Customer retention Once the elements of V-Techââ¬â¢s marketing campaign is identified, quantifiable goals can be set to counter financial loss and actionable measures can be taken to offset the losses for exchange of returnable gain. To begin identifying the elements of concern, V-Tech accounting management will look at: A. Product B. Place C. Price D. Promotion The product is an innovative technological breakthrough, meant to create real time life and learning experiences for its target audience. The product has little competition but may be hard to catch on in the marketplace and cause resistance within consumers. Quantifiable marketing goals that would need to be set: Be flexible to understanding that new products may need a longer campaign run. Placement metrics track the impact of consumer awareness and the impact of individual campaigns ability to reach marketing goals. Calculating metrics for analysis will determine if the whole of the marketing plan is bringing in more profit than it cost to run. Placement of the products marketing geographical and economic stature is an importantà quantifiable element. A metric analysis of location placement will measure the buying power and behavior of the consumer by geographic location. If the product is not selling well in placement, location factors may be that the target areas do not have the right selling class. Geographical metrics indicate a target audience income, medium house hold income, pay scale and if the economics of the area are depressed or thriving for businesses and product buying. The goal would then be to move the marketing campaign into better location areas where purchasing is a stronger asset for the product. Measuring the metrics of geographic locations can also help the company keep a competitive advantage as more technology companies advance to offering consumers a similar product. By being better able to understand consumer behavior by geographic V-Tech will have a higher ROI(return on investment) strengthen their marketing campaigns that keep customer retention, loyalty and target a larger audience base. Pricing by far may be the most important aspect in finding quantifiable controlling elements. A new product of technology changes the whole atmosphere of the market place from how it is developed to the price of manufacturing and distribution. The marketing of V-Techs new product is to reach a broad base of a consumer audience over affordability. This may cause a huge financial loss for the company. The campaign of the marketing needs increasing without the extra-added expenditures to cover the cost of loss and turn a profit. The reasoning behind quantifiable control is marketing the product to show value, and to measure financial gains where the product and marketing campaign will exceed profit and generate profit growth. The goals would then be to do a review of past sales to compare to sales of the new product and build on the strengths that previous campaigns have generated. A metrics analysis can be done in order to find out how many people clicked on an ad from online, what the numbers of new sales are and the percentage of new leads generated. From measuring sale metri cs, the company will be able to tweak the marketing campaign, generate a new marketing design, or repeat the campaign until the marketing goals meets its value. The company will also be able to determine the effectiveness of its Public relations effort in relation to its marketing efforts. A cost saving measurement to the company and the marketing campaign would be to get out in front of the face of the audience. Increase web activity, broaden the scope of social media awareness and depth in which marketing the product can help exceeded sales goals. The promotion of V-Techs product quantifiable control elements are to measure consumer awareness and set goals if the product is failing in brand awareness, website traffic, and not generating the sales lead expectations. Taking advantage of sending out Brand Ambassadors to area store locations and increasing trade market showings will promote and target the customer audiences awareness of the new product, how it is designed and will demonstrate why the consumer has a need to purchase the product. Social media marketing is limitless for brand awareness, in where a campaign can go to reach a borde r target buying audience. The quantifiable elemental goals are to take advantage of the use of the internetââ¬â¢s effectiveness of marketing to cost with web videos, direct coupons to the consumer, customer loyalty incentives, package discounts on education and parental sites. Identifying the quantifiable elements that help to control a marketing plan is an invaluable asset to V-Tech technologies and its new product launch. The analyzed metric data sets timely goals to which the company can redefine its control of marketing execution to increase sales and profits. The wealth of information extracted from the identification process takes on a new format that will find strengths and weakness of the consumer target audience, and will help to keep a competitive advantage as new companies move in the territorial locations of the innovative technology that V-Tech Windows will bring to a new market place.
Saturday, September 21, 2019
An Essay About Orbits Communications Essay
An Essay About Orbits Communications Essay The word orbit we hear it very often, whenever the space shuttle launched or it meets up ISS (International Space Station) or when a rocket launches a payload, we always come across the word ââ¬Ëorbit. But what actually the orbit is? An orbit is a specific path on which an artificial satellite revolves/travels around another body or planet .This path is regular and repeating .Satellite can be natural and artificial, like Moon .Moon itself acts like a satellite which travels around the Earth in a particular path. In the solar system , nine planets including Earth ,revolves around the sun in an orbit .Satellite that travels around the Earth are not in a constant distance from Earth, it varies .Sometimes its closer and sometimes far away. The closest orbit of satellite around the Earth is called ââ¬Å"perigeeâ⬠and farthest orbit called ââ¬Å"apogeeâ⬠. The time required for a satellite to complete full orbit is called a ââ¬Å"periodâ⬠. According to Isaac Newtons first law of motion, a moving object will remain in motion unless something pulls it or push it, and that is gravity. Without Earths gravity, satellite would go off in the space along a straight path .With Earths gravity it keep on pulled satellite back to Earth. To maintain the orbit, the gravitational force and the momentum of moving object have to be balanced. Another factor is Escape velocity. It is the speed of an object (satellite) to break free from the gravity of the planet and enters into a certain orbit. It depends on the mass of the planet and varies from planets to planets and the distance from the centre of the planet to the object (satellite) is also important. The escape velocity of Earth is approx. 11.3 km (7 miles)/hr. Orbital Velocity: Orbital velocity is the required speed needed for an object (satellite) to stay in an orbit. It is about and altitude of 242 km, approx 17,000 miles /hr. [4] SATELLITE ORBITS There are three different types of orbits High Earth orbit (Geostationary orbit), Medium Earth orbit (MEO), and Low Earth orbit (LEO).The orbit selected for satellite is depend on its usage and application. Direct Broadcast Programmes and weather communication satellites use Geostationary Orbit, as they are far away from the Earth and they travel in the Earths direction therefore looks stationary .Satellite navigation systems (NAVSTAR or GPS [global positioning system] ),designed to navigate a particular region or area and satellite phones are in MEO(Medium Earth Orbit). NASAs Earth Observing System and other scientific satellites uses LEO (Lower Earth Orbit). [5] [6] Earth orbits. [7] ORBITAL DISTANCES[8] , [9] Orbits Orbit Initials Miles Km 1-way Delay Orbit altitude (KM above earths surface) Low Earth Orbit (LEO) 100-500 160 1,400 50ms 200 1200 Medium Earth Orbit (MEO) 6,000 12,000 10-15,000 100ms 1200 35790 Geostationary Earth Orbit (GEO) ~22,300 36,000 250 ms 35790 Circular and Elliptical Paths There are two types of orbit paths, in which satellite travels around the Earth, circular and elliptical. In circular orbits, the distance between the earth and satellite remains same all the time. When a satellite orbit around the Earth, it creates a plane, which goes across the geo -centre or centre of gravity of Earth. If the satellite orbit with Earths rotation, it is called ââ¬Å"posigradeâ⬠and if it is in opposite direction, it is ââ¬Å"retrogradeâ⬠. The path of satellite around Earth is also defined. If the satellite travels directly overhead the Earth, it makes a circle which had the centre of gravity of Earth known as ââ¬Å"Ground Trackâ⬠and it consists of single point on Earths Equator. [10] Satellite orbit paths. [11] HEIGHT OF ORBIT The distance between satellite and earth or the height of orbit decides how fast the satellite is going to travels around the Earth. The satellite motion is always controlled by the gravity of the Earth. The more nearer the satellite is, gravity gets stronger and it travels more faster. For instance, NASAs Aqua satellite completes the period in 99 minutes around Earth at approx 750kms up, on the other hand a weather satellite takes 23 hrs, 56 mins, and 4 secs to complete a period at 42,164km away from Earth. If we look at Moons one complete period around Earth, it takes 28days at 384,403 kms from the centre of Earth. By changing the height of satellite, it effects on its orbital speed as well. For changing the speed of the satellites orbit, the satellite operator fire thrusters which helps the satellite to accelerate more. It would boost the orbit, in terms of increasing the altitude but it will slow the orbital velocity. Instead of that, the satellite operator should fire the thrusters in opposite direction of the satellite ,By doing this ,it will push the satellite into the lower orbit , which causes increment in orbital velocity. ECCENTRICITY OF AN ORBIT It directs to the pattern, shape of the orbit path. With a low eccentricity the satellite will move close to the Earth in circle (Lower earth orbit). The Eccentricity of an orbit refers to the diversion of orbit from an ideal circle path. With eccentricity of (e) = 0 the orbit forms a circular path, the value of eccentricity lies between 0 ~1.With high (e) = 0.9 the orbits forms an elliptical orbit, the nearest distance from Earth is called perigee and furthest distance is called apogee. In any elliptical orbit, it focused on two focal points, and one of them is geo-centre of Earth, Picture taken from [link] , (NASA illustration by Robert Simmon Another crucial factor is plane of satellite orbital path. An orbital inclination is the angle between the plane of the orbit with the equator of the earth. If the orbit is directly overhead the equator of Earth, it will have an inclination of 0à ° or 180à ° and generally it is called equatorial orbits .And if the orbit is passing over the north and south poles of the Earth , it will make and inclination of 90à °and known as polar orbits. Angle of Inclination [link1] , [link2]. Another feature is the angle of elevation, above the earths plane with a given location of earth and time. It plays an important role when a contact between satellite and earth station is required. Angle of elevation means, when the satellite appears on the horizontal axis of earth. Signals from Earth station may be interrupted if the angle is too small or if the earth stations antenna is not located on high altitude. Minimum of 5à ° angle of elevation is acceptable for satisfactory results. [link] All together, the satellite height, inclination and eccentricity helps to observe the satellite path and what vision it will have on the Earth. TYPES OF ORBITS HIGH EARTH ORBIT [GEO (Geostationary /Geosynchronous orbit)] When a satellite approaches 42,164 kms away from the centre of the Earth (approx 36,000kms from the surface of Earth) it enters into a special plane of orbit where its period starts matching the earths rotation and it orbits the same velocity as Earths. So, the satellite starts behaving as stationary over the Earths equator surface. This High Earth Orbit is known as Geosynchronous. A satellite moving in circular orbit directly overhead the Earths surface with eccentricity and angle of inclination at 0à °forms a geosynchronous also known as geostationary orbit. As it follows the Earth , so it completes its 1 period in 24 hours. GEO orbit is an ideal orbit for monitoring weather forecast events ,because in GEO orbit , the satellite can provide a constant image of same surface range as it follows the Earth.GEO stationary satellites like, GOES (Geostationary Operational Environmental Satellite) sends data after every few minutes about wind , regular inspection of cloud impressions and water vapours. Launched and built by NASA, operated by NOAA (National Oceanic Atmospheric Administration) .GOES satellite also helps to locate the ships and aeroplanes in distress situation. Earth images at different intervals of time. [link] As geostationary satellite is always on fixed single position, they can be useful for satellite phones, direct satellite broadcast, radio etc. Just beyond the bounds of High Earth Orbit, there are Lagrange Points. At these points the earths gravity pull cancels the Suns gravity pull .Any satellite placed on these points will get proportional pull towards the Sun and the Earth and it will start moving with the Earth around the Sun. There are 5 Lagrange points, L1 L2 are located opposite sides of the Earth i.e., night and day sides. L3 is located on the other side of the Sun, adverse side of the earth. Only are stable points , located at 60à ° above and behind the Earth in same orbit. On L1, L2 L3 any slight agitation will drop out the satellite out of Lagrange point. At these critical points, they need constant and regular adjustments to stay balanced within the orbit. But on L4 and L5 even if they get disturbed they return back to their initial point. Lagrange Points MEDIUM EARTH ORBIT Satellites which orbits in medium earth orbit they move more quickly as compared to GEO because they are closer to Earth. There are two types of medium earth orbits, Semi Synchronous orbit and Molniya Orbit. 1) Semi Synchronous orbit: This orbit is a near to circular orbit with a very low eccentricity, with a distance of 26,560 kms away from the centre of Earth approximately 20,200 kms from the Earths surface. At this distance, the satellite takes 12 hours to complete its 1 period/orbit. As satellite orbits, the Earth revolves under it and in 24 hours of time, the satellite come across the same 2 points everyday on the equator. This orbit is persistent and much more predictable. This orbit is used by GPS satellites (Global Positioning System). 2) Molniya Orbit: This is the second orbit in MEO, the Molniya orbit. Made by Russians, it works satisfactory for determining high latitudes. With the high eccentricity of 0.722 and inclination of 63.4à ° it forms a huge ellipse orbital path with the Earth, and it is very close with the Earth on one edge. Due to this, it gets accelerated by the earths gravity. As it orbits more faster when it is near to Earth and it slows down, when it moves far away .Due to the high eccentricity, it spends more time at the top of ellipse orbit. Similar to Semi Synchronous orbit, it takes 12 hours to complete its 1 period/orbit and in 24 hours of time, the satellite come across the same 2 points everyday .Molniya orbit is useful for communication in far hemispheres. This orbit is used by Russian communications satellites and the Sirius radio satellites. LOW EARTH ORBIT With a 160-1,240 miles altitude, it forms a low earth orbit in a circular path above the Earths surface. The satellites moving in this orbit complete one period/orbit in roughly 90 minutes. It means they can faster in LEO at approximately 17,000 mph.[link]. Mostly weather communication satellites and scientific satellites are in Low earth orbit .the satellites in LEO got different angle of inclination .the inclination angle depends on the purpose of what to monitor. For example, TRMM (Tropical Rainfall Measuring Mission) satellite tasked to monitor the rainfalls in the tropic regions. So that it has a low inclination of 35à ° and it is closer to the equator. NASAs Earth observing system satellites are in LEO and in polar orbits. As they orbits around the north to south poles, they are highly inclined and they takes 99 minutes to complete 1 period/orbit. In half of the period (e.g. north to south pole), they captured the daytime of Earths surface, and in second half period they capture the opposite night time side of the Earth. In 24 hours, the satellites in polar orbits capture the Earth twice, once in daytime and second in night time. The polar -orbiting satellites have one special spot on the equator which lets them to stay in 1 time. This orbit is a Sun Synchronous orbit which indicates that no matter whenever the satellite comes across the equator, the local solar time will be same on the ground as well. For example, Terra satellite, when it crosses the Brazil on equator the time is always about 10:30 am. After completing its one orbit in 99 minutes, when it next overpasses the Earth equator, it comes across the Ecuador or Colombia at about 10:30. The path of Sun-synchronous obit is very narrow. To maintain the sun -synchronous orbit, it is necessary for a satellite to achieve a height of 100 kms with an orbital inclination of 96à °. Accomplishing Maintain the Orbit: To launch a satellite into a particular orbit, an enormous amount of energy is required, and this energy is depends upon the height of the orbit, location of launch site and orbital inclination. For High Earth Orbits, requires huge energy boost just to reach their destination. Polar orbit satellites take more energy as compared to the satellites which are overhead the Earths equator as they didnt gets boost from earths momentum .The ISS (International Space Station) orbits at orbital inclination of 51.6397à ° and it helps other space shuttles to reach to it . Maintaining the Orbit: perturbation There are many factors which effects the orbital inclination of satellites. As in the solar system there are many other gravity pulls as well, such as from the Sun , Moon , and Jupiter , the biggest planet in the solar system NASAS LEO satellites , requires maintenance every year to maintain the inclination of sun-synchronous orbit. Satellites in LEO are also dragged out from their orbit because of the atmosphere. Satellites in lower earth orbit moves through the thinnest layers of the atmosphere where air friction is quite strong and it is more than enough to pull them out from the orbit or pull them closer to Earth. If the satellite comes closer to Earth, Earths gravity accelerates them to boost up, it will either burn up or fall down to earth. Air always rises and expands if heated. The air in the atmosphere rises and expands due to the Suns extra enormous amount of energy. The thinner sheet of atmosphere rises and thicker layer under it takes it place. Now, the satellite orbits in thicker layer instead of thinner layer. It creates more friction between the medium and the satellite. As there is a lot of space junk, orbital debris in orbital paths.
Friday, September 20, 2019
The Challenge Of Population Growth In Africa Economics Essay
The Challenge Of Population Growth In Africa Economics Essay It is generally agreed that the challenge of population growth is one of the most serious obstacles to development faced by LDCs in the 21st century. In the long process of human history, the relationship between the production of material goods and human reproduction is always interdependent. Therefore, a certain economy is the foundation of the existence and development of human beings; meanwhile, the reproduction of human beings is the condition for the development of economy. The historical experience has proved that the population growth has to keep relative balance with the development level of economy; otherwise, the human society will be punished by nature certainly. It is undeniable that the fertility of Africa is always out of control since the independence of African countries. In 1970s and 1980s, the average fertility rate of Africa reached 6.8 and 6.7; however, it was still high was around 5.4 in 2004 [1]. Besides the high fertility rate, the size of African population has never stopped increasing. In 1960, the African population was 282 million, which was 9.3à ¼Ã¢â¬ ¦ of the world population; however, in 2005, the African population had reached 906 million, which was 14.0à ¼Ã¢â¬ ¦ of the whole population in the world [2], in the 45 years, the African population increased trebly. Since Africa has the highest population growth rate and the second largest population in the world, the population burden will put more pressure on the development of economy though Africa is always suffering from poverty. To get through difficult situations, the African countries have to recognize the negative effects of rapid population growth on the developme nt of economy. First, the poor capital accumulation is the bottleneck of development in Africa. The development of economy requires solid foundation, and the material capital is the motive force of the development. The classical economist, Adam Smith emphasized that the accumulation of capital was the precondition of specialization [3]. For African least developed countries, they have abundant resource and labor, and the capital input can determine the level of economic development. Either of low capital output ratio and poor capital accumulation will hinder the development. According to the demographers estimation, an 1à ¼Ã¢â¬ ¦ increase on the population will lead the country to pay 3à ¼Ã¢â¬ ¦ to 4à ¼Ã¢â¬ ¦ of gross national income on the investment of additional population [4]. If more national income invests on the population growth, which means the investment on production will be limited strongly. As the rapid increase on the population in Africa, the structure of population is very you thful and the youth dependency ratio is always highest in the world [5]. Every year, African governments have to take a certain share of new output value to invest on the latest additional population, but Africa is also the region comprising many poorest countries. In 2000, the World Bank made public a name list of fifty nine poorest counties in the world, and thirty eight of them were in Africa [6]. Therefore, substantial fund have been ate by the large population, which leads to low saving ratio and large financial gap. The second negative effect of the large population on LDCs refers to the low quality of the population. In fact, the quality of population can determine the quality of labor directly, and human capital is always regarded as the key of the economic development. Theodore Schultz, the winner of the Nobel Memorial Prize in Economic Sciences, believed that a health and highly educated population was playing an important role in a countrys development [7]. However, the high rise of African population really hinders the improvement of human capital. On one hand, the investment from governments on education has fall much behind the rapid population growth in Africa, which leads to extremely heavy pressure on the education, such as the shortage of educational expenditures and teachers, low school enrollment ratio, high illiteracy rate. In 2001, the UNESCO reported that Africa was the poorest continent in education where the literacy rate was less than 60à ¼Ã¢â¬ ¦ [8]. On the other hand, sin ce the mid of 1970s, the African population growth rate was always going beyond the agricultural productivity rate, the self-sufficiency rate of grain and the per capita food expenditure kept decreasing. According to the Malthusian Population Trap, the universal tendency for the population of a country will grow at a geometric rate, however, the food supplies can expand only at a arithmetic tae [9]. Therefore, the food supplies can never satisfy the demand by rapid population growth in Africa. In fact, the African malnutrition population increased from 94 million in 1970s to 210 million in 1990s [10], and now the per capita food expenditure for African population reaches only 85à ¼Ã¢â¬ ¦ of the standard set by United Nations [11]. Since the African economy really depends on the agriculture and the export of primary products, the physical labor is still needed in the most regions. So, we have to doubt such large unhealthy and uneducated population could make contributions to the ec onomic development in 21st century. Third, the LDCs have to face the high unemployment rate which is brought by rapid population growth. Todaro points that an excess of job seekers over job opportunities in the LDC economy is the one of the major negative consequences of population growth [12]. In fact, it is normal that every country has a certain amount of people are in unemployment, but once the proportion of unemployment is excess, the economic development will be hindered and the whole society will become instable. Since the independence of Africa, every year the population within working age is becoming larger, and the labor force growth rate has excessed the economy growth rate, the economic sectors cannot create enough job opportunities to fulfill needs. In 1990s, there were average 10 million African people seeking job per year, however, the economic sectors could only absorb half of the additional labor force [13]. Even though the largest economy in Africa, the unemployment rate of South Africa was 41.8à ¼Ã¢ ⬠¦ in 2002 [14]. We can imagine how terribly high the unemployment rate of other more backward African countries is. Therefore, substantial labor force cannot be made full use of in Africa which really hinders the enlargement of production scale and optimization of industrial structure, in return, the economic backwardness will increase the unemployment rate. Eventually, it is hard for the LDCs to get rid of the vicious circle which combines high employment rate and poor economy. In fact, the population growth is a neutral phenomenon, in the 3/4 time of 20th century, the development of economy was accompanied by the population growth. However, the rapid population growth can slow down the economy growth and hinder the improvement of living standard, especially for LDCs whose foundation of economy is quite weak. If LDCs really want to achieve the Millennium Development Goals in 2015, they should recognize the importance of education and health to control the rapid population growth immediately.
Thursday, September 19, 2019
Free Handmaids Tale Essays: The Struggle of Women :: Handmaids Tale Essays
The Struggle of Women in The Handmaid's Taleà à The Handmaid's Taleà This is a futuristic novel that takes place in the northern part of the USA sometime in the beginning of the twenty-first century, in the oppressive and totalitarian Republic of Gilead. The regime demands high moral retribution and a virtuous lifestyle. The Bible is the guiding principle. As a result of the sexual freedom, free abortion and high increase of venereal diseases at the end of the twentieth century, many women, (and men also, but that is forbidden to say), are sterile. The women who are still fertile are recruited as Handmaids, and their only mission in life is to give birth to the offspring of their Commander, whose wife is infertile. The main character in the book is Offred, one of these unfortunate servants whose only right to exist depends on her ovariesââ¬â¢ productivity. She lives with the Commander and his wife in a highly supervised centre. Unlike men, women have been facing unique problems for centuries, and often women experience harassment and discrimination. In today's society, females are trying to combat their tribulations through lawsuits and protest rallies. Literature often deals with people being unable to articulate their problems. Often, unforeseen circumstances force people to conceal their true emotions. In The Handmaid's Tale, the main female characters find ways to escape their situations rather than deal with them. Offred from The Handmaid's Tale uses different tactics to cope with her situation. She is trapped within a distopian society comprised of a community riddled by despair. Though she is not physically tortured, the overwhelming and ridiculously powerful government mentally enslaves her. Offred lives in a horrific society, which prevents her from being freed. Essentially, the government enslaves her because she is a female and she is fertile. Offred memories about the way life used to be with her husband, Luke, her daughter, and her best friend Moira provides her with temporary relief from her binding situation. Also, Offred befriends the Commander's aide, Nick. Offred longs to be with her husband and she feels that she can find his love by being with Nick. She risks her life several times just to be with Nick. Feeling loved by Nick gives her a window of hope in her otherwise miserable life. Instead of proclaiming her feelings out loud, she suppresses them. The result is a series of recordings, which describes her life, and the things she wishes she could change. Free Handmaid's Tale Essays: The Struggle of Women :: Handmaid's Tale Essays The Struggle of Women in The Handmaid's Taleà à The Handmaid's Taleà This is a futuristic novel that takes place in the northern part of the USA sometime in the beginning of the twenty-first century, in the oppressive and totalitarian Republic of Gilead. The regime demands high moral retribution and a virtuous lifestyle. The Bible is the guiding principle. As a result of the sexual freedom, free abortion and high increase of venereal diseases at the end of the twentieth century, many women, (and men also, but that is forbidden to say), are sterile. The women who are still fertile are recruited as Handmaids, and their only mission in life is to give birth to the offspring of their Commander, whose wife is infertile. The main character in the book is Offred, one of these unfortunate servants whose only right to exist depends on her ovariesââ¬â¢ productivity. She lives with the Commander and his wife in a highly supervised centre. Unlike men, women have been facing unique problems for centuries, and often women experience harassment and discrimination. In today's society, females are trying to combat their tribulations through lawsuits and protest rallies. Literature often deals with people being unable to articulate their problems. Often, unforeseen circumstances force people to conceal their true emotions. In The Handmaid's Tale, the main female characters find ways to escape their situations rather than deal with them. Offred from The Handmaid's Tale uses different tactics to cope with her situation. She is trapped within a distopian society comprised of a community riddled by despair. Though she is not physically tortured, the overwhelming and ridiculously powerful government mentally enslaves her. Offred lives in a horrific society, which prevents her from being freed. Essentially, the government enslaves her because she is a female and she is fertile. Offred memories about the way life used to be with her husband, Luke, her daughter, and her best friend Moira provides her with temporary relief from her binding situation. Also, Offred befriends the Commander's aide, Nick. Offred longs to be with her husband and she feels that she can find his love by being with Nick. She risks her life several times just to be with Nick. Feeling loved by Nick gives her a window of hope in her otherwise miserable life. Instead of proclaiming her feelings out loud, she suppresses them. The result is a series of recordings, which describes her life, and the things she wishes she could change.
Wednesday, September 18, 2019
Nature v. Nurture in Mark Twains Puddnhead Wilson and Those Extraordi
Nature v. Nurture in Mark Twain's Pudd'nhead Wilson and Those Extraordinary Twins What makes a person who they are is a difficult dilemma. Mark Twain's novel, "Pudd'nhead Wilson and Those Extraordinary Twins" is a critical analysis of how nature and nurture can cultivate emotions and free will, which in turn affects the life of individuals. "Twain's faltering sense of direction began about slavery, moral decay, and deceptive realities (Kaplan 314). The debate of `nature versus nurture' has been one of the most intriguing scientific and cultural issues for most of the twentieth century, in determining the behavioral aspects of human beings. The changes in environment, society, education, political influences, family values and morals and other external influences, combined with physical genes determines how mankind will evolve into adulthood. Both nature and nurture, in combination with emotions and free will, control the behavior of human beings and determines who we are. Anthropologists, who study humans and their origins, generally accept that the human species can be categorized into races based on physical and genetic makeup. For example, many slaves had physical differences from their counterpart white race, such as dark skin and wiry hair. Throughout history, the study of Sociology has had a significant impacted the `nature versus nurture' debate. Social Darwinism based its theory on genetic determinism and natural selection, advocating a capitalist economy, promoting racism and the inherent inequality of such as society. Karl Marx, also an advocate for capitalism and slavery, applied the Marxist philosophy to the practice of science, emphasizing environmental influences determined behavior. Max Weber is known his ... ...lard Stern, Nahra, Nancy. American Lives. New York, NY: Addison Wesley Longman, Inc. 1997 Sandler, Martin W., Rozwenc, Edwin C., Martin, Edward C. The People Make A Nation. Boston, MA: Allyn and Bacon, Inc. 1975. Skinner, B.F. A Brief Survey of Operant Behavior. Cambridge, MA: B. F. Skinner Foundation. 1938 Skinner, Ellen A. Perceived Control, Motivation, & Coping. Thousands Oaks, CA: Sage Publications, Inc. 1995. Twain, Mark. Pudd'nhead Wilson and Those Extraordinary Twins. New York, NY: W. W. Norton and Company, 2005. Wachs, Theodore D. The Nature of Nurture. Thousands Oaks, CA: Sage Publications, Inc. 1992. Wilson, Jim. Criminal Genes. Popular Science. Pars International Corp. New York, NY. November 12, 2002. http://www.popularmechanics.com/science/research/1282176.html
Tuesday, September 17, 2019
The USPS Problem
It has come as no surprise that the United States Postal Service lost money in the first two quarters of 2010. $8. 5 billion to be exact. Next year they, plan to lose even more. Somewhere in between $9 billion to $10 billion dollars. The problem will not be as simple to fix, but it is a problem that can be resolved with a few simple implementations and cost cutting options. Overspending and undercharging has led to needing to cut cost and raise prices. The USPS is trying to do both, but it requires Congressional approval and some simple economics. Here is what should be done in solving this problem. 1. Raise prices.à Allow modest price changes without Congressional approval. If the prices change within the cost of living change or close the USPS should be able to implement them without wasting time and taxpayer money on a Congressional approval. The United States Postal Service does not charge enough for the service they provide. It does not cost 44 cents to move a letter from San Antonio, Texas to Hawaii, Alaska, or Puerto Rico. It does not cost 44 cents to move a letter to the next town let alone cross country with todayââ¬â¢s raising fuel cost. Even with todayââ¬â¢s new Postal pick up service the cost of fuel outweighs the cost of flat rate packaging. 2.à Service. Service is part of the United States Postal Service name. End the Casual implantation of temporary workers. To many times customers complain to me that they saw a worker delivering mail without a uniform, and do not trust them in picking up the mail or package. Mail carriers should promote the business and make every interaction with its customers a positive one. I do many routes at my station and time and time again customers complain of the grumpy old letter carrier acting rude when approached, this has to come to a halt and management should be more involved in implementing ways to improve customer interaction and promote it. If a station manager gets complaints on a mail carrier, the station manager should make a note of it and speak to the mail carrier at the end of day or first thing in the morning. Allow private business to run kiosk machines. Co-location works, and it is what the customers want, pay flat rate prices and do so fast and quickly, not waiting 20 to 30 minutes in line at the local Post Office. 3. Either end the retirement and health care pre-funding or make all government agencies abide by the same rule the United States Postal Service does. Although this has little impact on mail delivery, it has a huge impact on postal profitability. The United States Postal Service officials think if given the same approach as other government agencies, they would save $5. 6 billion a year in revenue. If it werenââ¬â¢t for the cost of pre-funding future retireeââ¬â¢s health care benefits the service would have seen a profit of more than a quarter billion dollars. In other words, from an operational standpoint, the United States Postal Service made money. Understanding that the United States Postal Service is to break even, and any profits gain are to be made into the retirement and health care fund. Pre-funding is a Congressional candy jar anyway. 4. Cut money wasting ideas. Management time and time again has cost the United States Postal Service revenue. Looking at some ideas management came just make no sense, like the idea to emplace a GPS system in every United States Postal Service vehicle. This idea was implemented to track and follow where the letter carrier goes during his delivery route. Along with that comes the idea to emplace 12 barcode scan points along the delivery route which the carrier must scan in increments of 45 minutes. Rather than spend that kind of money and ways to spy on the letter carrier, someone in upper management should have suggested the idea that most of the United States Postal Service competitors have, which is continuous visibility of parcels. A idea that can make the United States Postal Service prove to their customers and competitors, that the United States Postal Service can provide the same service if not better than the other agencies. Currently the United States Postal Service cannot show the time of delivery of any package until the letter carrier returns to the office and downloads the information into the system. Also batteries on the scanners fail and data is lost as well as the cost of a scanner brought to the letter carrier to be replaced. Instead of a GPS in every truck it would wise to spend revenue on something the United States Postal Service can improve its operational needs and improve visibility for every parcel scanned. After all it is what the business side of customers wants to see. The United States Postal Service is established so that every citizen could have an affordable means to move packages, and letters and to ensure timely delivery of mail to each home is delivered. The Postal Service has tremendous business potential in the future, but Congress has to allow the United States Postal Service to use its own money in a businesslike fashion to get over the short term challenges,â⬠NALC President Fredric Rolando said. With the ever-changing market the United States Postal Service must focus on the parcel side of business mailing, and ensure every interaction with its customers is a positive one. After all it is the United States Postal Service customers that can fix the revenue problem the service is having.
Monday, September 16, 2019
Linear and staff management
Managers have different titles in various organizations. No matter what the label is, there is a difference in authority between line and staff management. There are two basic kinds of management positions: line and staff. Linear Management Staff Management 1 . The most common of all formal relationships in organizations today is the supervisor-subordinate one.This line or operational supervisor, whatever his title, has the power and authority to direct the actions of the subordinate who is accountable for carrying out certain duties. . The supervisor might use any one or combination of many management styles in working with his staff, but he will see that there are results. It's those results that produce revenue, whether it's profit from a business or non-profit grants from the government. 1. The staff manager or supervisor is in a position that supports line management.He is usually a specialist of some kind. Examples are the manager of the IT department, and the director of HR. 2 . Managers in these positions do not have the authority to tell the line staff how to do the work for which the organization exist. Instead, the taff manager or supervisor is responsible for making sure all the supports are in place so the line staff are hired, trained, equipped and supported while they carry out the actual operations. 3. Staff management authority is very different from line management authority.While the line manager makes sure that there is revenue, the staff manager often has to spend that money to support further operations. This can lead to tensions in the workplace, especially when there is no clear understanding of the difference in the authority of the positions. Relationship Between Line and Staff Management ere are four ways of looking at the relationship a staff manager has with a line manager. Prescribe. To do this, a staff manager can prescribe certain procedures in his specialist area.For example, he can develop and implement recruiting policies and p rocedures that are used across the organization. The line manager is expected to follow those organizational procedures unless he has a solid rationale for within his specialization. For example, a line manager might propose that two of his staff attend certain management courses. The staff manager of the training section can concur with or veto this proposal as it is within his specialty. Be heard. A staff manager has the right, the authority, to participate in the discussions, if not the decision-making, pertaining to his specialty.For example, the manage in HR maybe not have a veto vote on a new recruit, but he does have the right to voice his opinion on the suitability of the candidate. Be informed. This function authorizes the staff manager to be informed within certain areas of activity. A common example of this is the position of director of finance. An operations, line manager has full authority to spend funds as he pleases within his budget, but he is required to keep the d irector of finance informed.
Sunday, September 15, 2019
Nintendo market analysis
1. à Who is the market?Nintendo is a gaming company. The companyââ¬â¢s gaming is almost entirely concentrated on electronic games and interactive entertainment. Its main products are video games, handheld games and console games (Nintendo Corporate)2. Who is the target market?The target market of gaming companies are people in the age group of 5-34 years. However, the growth in this industry is occurring in the demographic of 18-34 years (Rye)3. à Who is the served market?The primary target market which Nintendo serves is to the 5-17 year old gamers. However, choice for buying such games lie with their parents, Nintendo also has an indirect target in them (Rye)4. What is the size of the target market?Currently the Video game market is $19 billion dollars, with about $8.4 billion dollar market in US, and $9.8 billion dollar market in the Asia Pacific region (Kolodny 2006)5. How fast is the market growing (%/yr)?PricewaterhouseCoopers predicts that by 2010 the video game market should grow to $46.5 billion. This means an average compount annual growth rate of 11.4%. The US market is likely to grow at the rate of 8.8%, to hit $13 billion in 2010, and the Asia Pacific market is likely to grow at the rate of 12.3% to hit $17.4 billion by 2010 (Kolodny 2006)6. à How far the market is penetrated (%)?Nintendo of America has achieved remarkable market penetration. It's estimated that 40 percent of American households own a Nintendo game system (Brown 2007). Worldwide Nintendoââ¬â¢s market share is 21.2% (Shim 2005)7. What are customers` current needs?Currently the video game customers need games which are aimed at adults rather than kids. The game market for kids, has reached its saturation, and the need of the hour is building games aimed for older people (Borow 2003)8. à What are customers` future needs?In future, with the wider spread in online and wireless games, customers need to have video games which will be less expensive and portable. They would a lso need to have these systems easily run in a network, which is the prime reason for the rage of PC games (Jackson)9. à What are current distribution channels?Nintendoââ¬â¢s products can be either brought off the shelf from various game shops; currently there are many games which could be played online too. In addition, Nintendo also plans to go in for digital distribution with the Wii and Virtual console distribution channels (Nintendo Corporate)10. How price-sensitive are customers?Nintendo was earlier known for price fixing, when the customers were more interested in the product than the price. The advents of wireless and online games have reversed the trend, where the customer goes for buying the least expensive of the products, if the quality is good (Molnar 2007)11. à What is the current pricing strategy?The current pricing strategy of Nintendo is by continuing their investment with the GameCube. This has allowed them to keep hardware development and manufacturing cost s down. This has made theme only current generation console that has profited from the hardware at the time of launch (Molnar 2007)12. What are some market/customer trends?Despite the great figures of growth etc, the market share for the console markets will be decrease with respect to the entire gaming market. This is due to the shifting of customer interests from console games to online and wireless games, which are seeing an explosive growth rate (Kolodny 2006).ReferencesBorow J, ââ¬Å"Why Nintendo wonââ¬â¢t grow upâ⬠, January 2003,https://www.wired.com/2003/01/nintendo-4/Brown R, ââ¬Å"Achieving a fast Return on investmentâ⬠, 2007http://www.hytrol.com/web/casestudy.cfm?id=35Jackson, ââ¬Å"Where you should competeâ⬠,http://www.lek.com/UserFiles/File/Jackson_ch01.pdfKolodny L, ââ¬Å"Global Video game market set to explodeâ⬠, 23rd June 2006, Nintendo Market Analysis Who is the market? Nintendo is a gaming company. The companyââ¬â¢s gaming is almost entirely concentrated on electronic games and interactive entertainment. Its main products are video games, handheld games and console games (Nintendo Corporate)Who is the target market? The target market of gaming companies are people in the age group of 5-34 years. However, the growth in this industry is occurring in the demographic of 18-34 years (Rye)Who is the served market? The primary target market which Nintendo serves is to the 5-17 year old gamers. However, choice for buying such games lie with their parents, Nintendo also has an indirect target in them (Rye)What is the size of the target market? Currently the Video game market is $19 billion dollars, with about $8.4 billion dollar market in US, and $9.8 billion dollar market in the Asia Pacific region (Kolodny 2006)How fast is the market growing (%/yr)? PricewaterhouseCoopers predicts that by 2010 the video game market should grow to $46 .5 billion. This means an average compount annual growth rate of 11.4%. The US market is likely to grow at the rate of 8.8%, to hit $13 billion in 2010, and the Asia Pacific market is likely to grow at the rate of 12.3% to hit $17.4 billion by 2010 (Kolodny 2006)How far the market is penetrated (%)? Nintendo of America has achieved remarkable market penetration. It's estimated that 40 percent of American households own a Nintendo game system (Brown 2007). Worldwide Nintendoââ¬â¢s market share is 21.2% (Shim 2005)What are customers` current needs? Currently the video game customers need games which are aimed at adults rather than kids. The game market for kids, has reached its saturation, and the need of the hour is building games aimed for older people (Borow 2003)What are customers` future needs? In future, with the wider spread in online and wireless games, customers need to have video games which will be less expensive and portable. They would also need to have these systems e asily run in a network, which is the prime reason for the rage of PC games (Jackson)What are current distribution channels? Nintendoââ¬â¢s products can be either brought off the shelf from various game shops; currently there are many games which could be played online too. In addition, Nintendo also plans to go in for digital distribution with the Wii and Virtual console distribution channels (Nintendo Corporate)How price-sensitive are customers? Nintendo was earlier known for price fixing, when the customers were more interested in the product than the price. The advents of wireless and online games have reversed the trend, where the customer goes for buying the least expensive of the products, if the quality is good (Molnar 2007)What is the current pricing strategy? The current pricing strategy of Nintendo is by continuing their investment with the GameCube. This has allowed them to keep hardware development and manufacturing costs down. This has made theme only current generat ion console that has profited from the hardware at the time of launch (Molnar 2007)What are some market/customer trends? Despite the great figures of growth etc, the market share for the console markets will be decrease with respect to the entire gaming market. This is due to the shifting of customer interests from console games to online and wireless games, which are seeing an explosive growth rate (Kolodny 2006).ReferencesBorow J, ââ¬Å"Why Nintendo wonââ¬â¢t grow upâ⬠, January 2003,http://www.wired.com/wired/archive/11.01/nintendo.htmlBrown R, ââ¬Å"Achieving a fast Return on investmentâ⬠, 2007http://www.hytrol.com/casestudy.cfm?id=35Jackson, ââ¬Å"Where you should competeâ⬠,http://www.lek.com/UserFiles/File/Jackson_ch01.pdfKolodny L, ââ¬Å"Global Video game market set to explodeâ⬠, 23rd June 2006,http://www.businessweek.com/innovate/content/jun2006/id20060623_163211.htmMolnar J, ââ¬Å"The Wii Played an impressive openingâ⬠, 22nd March 2007,http:/ /blogs.spouting-tech.com/thepensivegamer/2007/03/the_nintendo_wi.htmlââ¬Å"Nintendo Corporateâ⬠, http://www.nintendo.com/corp/Rye C, ââ¬Å"Market Research: Nintendo DS ââ¬â Marketing strategyâ⬠http://court.ryefamily.net/files/Nintendo-DS-Marketing.docShim R, ââ¬Å"Next-gen Consoles take front stageâ⬠, 12th May 2005,à à à à à à à à à à à http://www.zdnetindia.com/news/features/stories/121828.html
Saturday, September 14, 2019
Great Corn Laws Debate
Given their numerous wars with France, Protectionists also argued that Great Britain had some public debt that would need o be repaid and this would be done primarily through taxing the farm land. Since the landowners taxes would be going up the stabilized commodity prices were thought to help offset their increased taxation. The last argument and most important according to the protectionists is in regard to national security. If there was no Corn Law, then Great Britain might become dependent on foreigners or enemies for their food supplies in the event they cannot produce enough for their own demand.The protectionists warn that trading partners can cut off supply at any given time and it is necessary to be independent when it comes to the food supply. The free-trade crowd had a differing opinion from the protectionists. Represented mainly by the manufacturing owners and eventually the laborers, they argued that artificial corn prices drove up prices everywhere else In the economy. Bread cost more to buy and food was the main expense of the labor class. Along with food rising so did the labor costs across various sectors such as manufacturing which In turn made them more expensive compared to their competition In other countries.The free-trade crowd also noted that protected agricultural price laws were driving p demand for the land which normally wouldn't be used In agricultural production. This Is seen as a competitive disadvantage because It would take away manufacturing opportunities which may help Great Britain globally. Great Britain lawmakers concede there will be dependence on foreign countries for a food supply and the free-trade crowd points out the fact Great Britain Is wasting resources on developing commercial land for farming.The free-trade crowd also makes the argument that national security would not be In Jeopardy because trade partners would be dependent on the manufactured goods Great Brutal supplies and that loud give them leverage to rema in viable trading partners. Given the arguments above It Is pretty clear that Robert Peel had a big decision to make. On one hand, Britain was the world's leading economic power and had attained this by being a protectionist's economy but at the same time these polices were harming the labor class through higher priced goods, higher rents along with lower or no wages.Something had to be done to reverse this and there was growing opposition to the Corn Laws by the day. A political action group called the ââ¬Å"Leagueâ⬠was formed and supported the free-trade agenda along with becoming a voice for he labor class. Through the League, more and more power was able to shift away from the landowners and Into the manufacturing owners along with the laborers. The League needed support from the labor class and they pretty much won them rising pressure from the citizens. By repealing these Corn-Laws many in power might have seen Peel as a radical for doing this but will eventually come a round and praise him.I didn't see any mention of Peel being a farmland or manufacturing owner so he literally had no hidden agenda other than do what was best for Britain. By participating in free-trade instead of protectionism, Britain could reallocate sources effectively as mentioned by Adam Smith's assertion of ââ¬Å"if a foreign country can supply us with a commodity cheaper than we ourselves can make it, better buy it off them with some part of the produce of our own industry, employed in a way which we have some advantageâ⬠. The Adam Smith quote to me pretty much tells the story.Since Britain is perceived strongly as a manufacturer then it is more prudent to be known for manufacturing and not for protecting grain trade. Through free-trade, Britain should be able to acquire the additional food for the citizens by importing from trading partners. There are implications for these actions but in the end the market always seems to prevail. Short term implications for Peels de cisions could leave the agricultural industry itself in shock initially given they are now competing globally and there won't be a fixed price for commodities.This would bring down food costs for the citizens but may also cause some of the farms to cut Jobs because of protected crop prices that are significantly higher than the US prices in the appendices. The farming industry in this time period more than likely looked like the 2008 financial crisis in the housing market in the short term. Rent for farmland couldn't be paid because of crop supply and demand being out of control due to Mother Nature yet the pricing structures for rent and crop pricing didn't really account for this.This short-term farming depression might have spread into the other sectors initially but over time I see the markets coming in to balance things out. Once the government is out of the way in terms of regulating the market, the invisible hand is able to work. Long term, land that is not suitable for farmi ng is now used for manufacturing in Britain which in turn leads to more Jobs being created. Competition for agricultural commodities brings down food prices for the labor crowd which then puts money back into the economy.Long term trends would also show trading partnerships develop across allied countries provided they work out appropriate trade arrangements and trade with each other based on their own comparative strengths. I would also note in the long term, more power is shifted between the landowners to the labor class giving them a voice in the long run. Part of this whole debate in my eyes comes down too power grab. Atone point, protectionism made sense for Britain but later on it Just ere out of control.The manufacturers eventually saw the light and conceited on protectionism but the agricultural sector did not. The power seemed to blind the landowners and mask what was going on. Prices across the board were rising on everything except the agricultural commodities and the lab orers were getting tired. The laborers eventually received a voice by Joining forces with the ââ¬Å"Leagueâ⬠and helped move Britain towards free-trade in my opinion. I believe Robert Peel saw this momentum along with the destruction the protectionism caused by stifling competition and had to act by repealing the Corn Law.
Friday, September 13, 2019
HOW TO BE AN EFFECTIVE SUPERVISOR Essay Example | Topics and Well Written Essays - 1000 words
HOW TO BE AN EFFECTIVE SUPERVISOR - Essay Example The supervisor should honor employees by setting aside time to attend them on weekly or daily basis and share with them if there is any problem, if there is any, the supervisor must find a way on how to help. Engage in regular meetings; hear employeesââ¬â¢ triumphs and grievances. Use meeting sessions to discuss the organizationââ¬â¢s success and find solutions to any new problem. Conflicts in the work place are common, and they may occur between a supervisor and employee or a client and the worker. Being a problem solver and an effective controller, the supervisor should remain to the facts and creatively think on how to handle the situation (Rue, 2010). The supervisor should at all the time avoid focusing on blame and emotions. Come up with the necessary steps to help solve the problem and let employees regain and resume to duties. As part of an effective supervisor, one should assist workers to transform their weaknesses to strength and competences. The supervisor should create awareness of the department which requires improvement. The supervisor should avoid showing unnecessary attention to weaknesses. Too much focus to employeesââ¬â¢ weaknesses may result to reduced employee morale and discouragement. Appreciate employeesââ¬â¢ work, which displays desired results (Rue, 2010). To be an effective supervisor one should design documents, which outline employeeââ¬â¢s duties and responsibilities and who is to carry out which task. This delegation of responsibilities will save workersââ¬â¢ time and eliminate errors on tasks. Schedule sessions for training to employees. Create training manuals to help workers on performing tasks and at the same time allow sessions for question and answer for employees to learn new tasks (Rue, 2010). Planning is the key management function. It involves chalking out the future level of action and advance decision making. It closes the gap between where we are and where
Thursday, September 12, 2019
Premier profile Essay Example | Topics and Well Written Essays - 1250 words
Premier profile - Essay Example It will explore some background information about him, his contribution to federal-provincial relations and finally his political legacy. Rene Levesque was born in August 24, 1922 and later died in November 1, 1987. He started his career as a reporter and a journalist then later went into politics. In his political life he served as a minister of the government of Quebec (1960-1966) and was founder of the political party, Parti Quebecois. As the 23rd premier of Quebec between the periods (November 1976- October 1985) he became the first political leader since the confederation that attempted to negotiate the political independence of Quebec. Rene Levesque was born in Campbellton in New Brunswick and was brought up in New Carlisle in the province of Quebec by his parents Dominic Là ©vesque who was a lawyer by profession and Diane Levesque in the Gaspe Peninsula. He went to school at the seminaire de Gaspe and then later joined Saint-Charles Garnier College. From there he joined Universite Laval in Quebec City to pursue a degree in law. In 1943, Là ©vesque quitted his studies and left the university without completing his degree. From quitting university Là ©vesque went into journalism and joined the radio station called CHNC located in New Carlisle. While at the radio station Là ©vesque became a substitute announcer for CHRC and then later announced for CBV. His journalism career looked promising when he went to serve as a correspondent and a liaison officer for the USA army in Europe during the Second World War (Wall, 2014). During his stay in Europe, he was based in London where he made his reports through the print media and on the air waves. From there he went to work as a reporter for the Canadian Broadcasting Corporation. He again worked for CBC as a war correspondent in the Korean War. While working as a journalist he got married to Louise Lââ¬â¢Heureux with whom he had three children with. Levesque gained fame and popularity when he started
Wednesday, September 11, 2019
Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words
Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was
Developing Business Processes and Operations Essay
Developing Business Processes and Operations - Essay Example Applying tools such as fishbone diagram, workflow diagram and decision matrix, it was found that appointing an editor will be the most logical and feasible solution to level the situation. Business concept had undergone a major change in 1980s. ââ¬Å"It was the realization by management that the business and manufacturing processes, not the people, is the key to error free performanceâ⬠(Harrington, 2007). Since then, organisations have been continually striving to escalate the business processes and related operations to the level of perfection as it has been observed through the 1990s till date that ââ¬Å"stockholders are not looking for good quality ââ¬â they want perfectionâ⬠(Harrington, 2007). For the purpose of this research I have chosen a start up organisation which consists of three teams each handling a distinct process. Team A performs online journalism and prepares news reports for various websites; Team B prepares international tests preparatory tools and Team C caters management solutions to retail clients. The three teams are autonomous in their functioning and have individual team leaders. A separate business development team headed by the CEO looks after networking and client development. Team wise client allocation is determined through weekly meetings as well as on ad hoc basis. The company has been enjoying considerable reputation in its sector and is also planning to diversify its operations and services in other locations as well. It is in a growth mode and is looking forward to increasing its employee base in terms of the existing units and especially a dynamic marketing department. Following implementation of this plan the workforce is expected to be doubled over a period of 9-12 months. It is also expected that the revenues will be remarkably enhanced in the next quarter. The current business scenario
Tuesday, September 10, 2019
Healthypeople Essay Example | Topics and Well Written Essays - 250 words
Healthypeople - Essay Example People now tend to behave as consumers, through more responsibilities and choices they become more active participants in improving and managing their healthcare. Consumerism is evident in the healthy people 2020 as the healthy people strives to identify the improvements to be made in the health department, increase the public understanding and awareness in the determinants of disability health and disease and identify research, evaluation and the needs for data collection. The healthy people 2020 aims at ensuring that the consumers of heath care are more informed, healthier and, more collaborative (Braveman, 2014, p.29) The institute of medicine in the healthy people 2020 focuses on the consumers as they aim at the promotion of health and giving objectives for disease prevention. These reports give guidance and create awareness on different types of diseases and the best methods of prevention. Through this reports the consumers get up to date information regarding healthcare and are able to take better care of themselves, an example includes the article written on type 2 diabetes prevention. The consumers should be open to the information provided to them and should take it seriously in order to benefit from it and improve their health status (Finkelman,
Monday, September 9, 2019
Writing to Persuade Essay Example | Topics and Well Written Essays - 1000 words
Writing to Persuade - Essay Example 003, 22) Those who want the death penalty continued often make their arguments on the grounds of philosophical or psychological speculation stating, ââ¬Å"The fact that a state can be just and apply the death penalty does not, of course, mean that the death penalty cannot be applied in errorâ⬠(Sorell, 2002, 30). A more reality-based perspective is wanted when discussing the actual issue of the death penalty. Overall, the death penalty is not an effective deterrent to many crimes, including murder. Even though this is one of the main reasons given by its advocates, other conclusions make more rational sense. Murder, is most often done in the heat of passion or under the influence of drugs or alcohol. In this state, the person is not cognizant of the outcome of their actions; they are acting on impulse rather than planning out what they are doing. And most murders do happen this way. Those that do not are generally preplanned and worked out so that the perpetrator does not expect to receive any punishment at all. In neither of these cases is the murderer thinking of the death penalty: in the first case, they are not thinking of the future at all, and in the second, they are assuming they are not going to be caught. In both of these cases, the death penalty is not doing anything to stop the murder from happening; it is simply assuring that, to paraphrase Martin Luther King, an eye for an e ye is going to keep making the whole world blind. States that do not have the death penalty do not have greater murder rates than those that do. This exposes the practice as essentially barbaric and
Subscribe to:
Posts (Atom)